ITT Cancer Research – Apoptosis – Oncology

Vit B12 Elisa Cusabio

VIT cloning plasmid

CSB-CL025862HU-10ug 10ug
EUR 663
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1974
  • Sequence: ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTGGTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACTGTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCA
  • Show more
Description: A cloning plasmid for the VIT gene.

Cusabio Laboratories manufactures the vit b12 elisa cusabio reagents distributed by Genprice. The Vit B12 Elisa Cusabio reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cusabio. Other Vit products are available in stock. Specificity: Vit Category: B12 Group: Elisa Cusabio

Human Vitamin B12, VB12 ELISA Kit

1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Vitamin B12, VB12 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Vitamin B12, VB12 ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Vitamin B12, VB12 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Vitamin B12, VB12 ELISA Kit

1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Rat Vitamin B12, VB12 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Vitamin B12, VB12 ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Rat Vitamin B12, VB12 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Vitamin B12, VB12 ELISA Kit

1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Mouse Vitamin B12, VB12 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Vitamin B12, VB12 ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Mouse Vitamin B12, VB12 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Bovine Vitamin B12, VB12 ELISA Kit

1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Bovine Vitamin B12, VB12 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Elisa Cusabio information

Mouse Vitamin B12, VB12 ELISA Kit

CSB-E07905m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Mouse Vitamin B12, VB12 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Vitamin B12, VB12 ELISA Kit

1-CSB-E07905m
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Mouse Vitamin B12, VB12 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Bovine Vitamin B12, VB12 ELISA Kit

CSB-E14089B-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Bovine Vitamin B12, VB12 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine Vitamin B12, VB12 ELISA Kit

1-CSB-E14089B
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Bovine Vitamin B12, VB12 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

VIT siRNA

20-abx939429
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VIT siRNA

20-abx939430
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Vitrin (VIT) Antibody

abx025749-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vitrin (VIT) Antibody

abx025749-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Vitrin (VIT) Antibody

abx037299-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human Vitrin (VIT)ELISA Kit

201-12-2616 96 tests
EUR 440
  • This Vitrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Bovine Vitrin, VIT ELISA KIT

ELI-22520b 96 Tests
EUR 928

Human Vitrin, VIT ELISA KIT

ELI-51481h 96 Tests
EUR 824

Mouse Vitrin, Vit ELISA KIT

ELI-40267m 96 Tests
EUR 865

Human Vitrin(VIT)ELISA Kit

QY-E04105 96T
EUR 361

Vitamin B12

B2063-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Vitamin B12

Vitamin B12

B2063-50 50 mg
EUR 128
Description: Vitamin B12