ITT Cancer Research – Apoptosis – Oncology

Serum Ephb2 Elisa Assay

Lab Reagents

Human IgG antibody Laboratories manufactures the serum ephb2 elisa assay reagents distributed by Genprice. The Serum Ephb2 Elisa Assay reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact serum elisa. Other Serum products are available in stock. Specificity: Serum Category: Ephb2 Group: Elisa Assay

Elisa Assay information

EPHB2 Antibody

21696-50ul 50ul
EUR 187

EphB2 antibody

10R-2137 100 ul
EUR 435
Description: Mouse monoclonal EphB2 antibody

EPHB2 Antibody

CSB-PA945346-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EPHB2. Recognizes EPHB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EPHB2 Antibody

CSB-PA945346-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EPHB2. Recognizes EPHB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EPHB2 Antibody

1-CSB-PA007730LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPHB2. Recognizes EPHB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EPHB2 Antibody

1-CSB-PA008070
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EPHB2. Recognizes EPHB2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

EPHB2 Antibody

CSB-PA616225-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EPHB2. Recognizes EPHB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EPHB2 Antibody

CSB-PA616225-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EPHB2. Recognizes EPHB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EPHB2 Cell ELISA Kit

abx595205-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

EPHB2 ELISA Kit (Human) (OKCA01225)

OKCA01225 96 Wells
EUR 846
Description: Description of target: Receptor tyrosine kinase which binds promiscuously transmembrane ephrin-B family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Functions in axon guidance during development. Involved in the guidance of commissural axons, that form a major interhemispheric connection between the 2 temporal lobes of the cerebral cortex. Also involved in guidance of contralateral inner ear efferent growth cones at the midline and of retinal ganglion cell axons to the optic disk. In addition to axon guidance, also regulates dendritic spines development and maturation and stimulates the formation of excitatory synapses. Upon activation by EFNB1, abolishes the ARHGEF15-mediated negative regulation on excitatory synapse formation. Controls other aspects of development including angiogenesis, palate development and in inner ear development through regulation of endolymph production. Forward and reverse signaling through the EFNB2/EPHB2 complex regulate movement and adhesion of cells that tubularize the urethra and septate the cloaca. May function as a tumor suppressor.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

EPHB2 Blocking Peptide

AF5246-BP 1mg
EUR 195

EphB2 Blocking Peptide

BF0703-BP 1mg
EUR 195

EPHB2 Conjugated Antibody

C21696 100ul
EUR 397

EPHB2 cloning plasmid

CSB-CL007730HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1449
  • Sequence: atggctctgcggaggctgggggccgcgctgctgctgctgccgctgctcgccgccgtggaagaaacgctaatggactccactacagcgactgctgagctgggctggatggtgcatcctccatcagggtgggaagaggtgagtggctacgatgagaacatgaacacgatccgcacgt
  • Show more
Description: A cloning plasmid for the EPHB2 gene.

EphB2 Polyclonal Antibody

ES5135-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EphB2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EphB2 Polyclonal Antibody

ES5135-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EphB2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EPHB2 Blocking Peptide

20-abx161846
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.